May 25, 2005
Those durned creatures
Way back in the mists of time, many moons ago, I mentioned we had a little mouse problem. The little mouse problem turned into a bigger mouse problem and first live traps, then deadly traps, then poison, then the exterminator were all called in to address the issue. Ultimately, after the exterminator pumped a bunch of black foam into the nooks and crannies of our apartment, we considered the War on Mouse over and packed up.
Well, the Mouse Menace has returned (I really shouldn't say menace, they are so very cute except when they are chewing inside the walls) and so the exterminator may have to return. But through all this I was a conscientious objector, so to speak, because despite the first sighting being in my room, I had neither heard nor seen them anywhere except occasionally in the kitchen.
No longer. Those little scurriers have penetrated my room's defenses and have been spotted running free, as well as waking me up at 4am with their incessant chewing. I first noticed it last morning, right after I dropped Matthew off at the airport (he leaves, and they decide his room isn't good enough for them any more, so they have to invade mine!) I thought it might be a fluke, though, because maybe I left my door open and one happened to come in. I didn't think they were actually getting into my room directly.
This morning, however, I was awoken (at the aformentioned ungodly hour) and could distinctly hear chewing coming from the vicinity of my radiator pipe. Eventually (at what time I could not say, the morning was quite a blur) I got a Brillo pad from the kitchen and jammed it into the space between the pipe and the floor. They can't chew through steel wool, and so this is supposed to keep them out real well. Apparently though my steel wool trick only managed to block the little bugger's exit route and so I spent the next hour and a half being spooked by the guy running all around my room.
Chatting with Becca this morning revealed her family's secret: Dryer sheets. The mice hate dryer sheets, apparently. Makes sense -- they throw all sorts of nasty chemicals in those things that are ok for humans to breathe but are nearly toxic to little beasties. She suggested I buy a few and throw them around.
I went to CVS after lab today and grabbed some CVS brand sheets (hey, they were cheaper). Good thing, too, cause when I got back to my room I found my Brillo pad all over the floor! Those cunning creatures managed to push it out of the way... despite it being filled with powerful, grease-cutting soap. I immediately took a dryer sheet, pulled it apart and jammed it deep into the hole, followed by the tattered remnants of the Brillo pad. I also cut another sheet to fit around the pipe and sit on top. Plus, I'm leaving the whole box nearby just in case they didn't get the message.
No signs yet but they usually don't appear until the early morning. Come 4am tomorrow, the battle continues. If this tactic does not succeed, however, I have another option. At CVS they also had glue traps - sheets of glue that the mice step in and then can't get out. I bought some, although I would prefer not to use them. At least with the glue traps I have a dim hope that I could somehow figure out how to free the mouse (outside, of course!) and they would actually work, as opposed to those quaint little live traps that they avoid.
Ultimately, though, I think the exterminator will have to come by, and shove more of that black foam in to plug up this little mouse hole. But despite my affection for the creatures, I will not tolerate any sort of scurrying or chewing activity. The mice must go.
Posted by kgutwin at 09:21 PM | Comments (1) | TrackBack
May 24, 2005
Reading The Story of Life
Who wants to learn about DNA sequencing? Come on, come on, it's pretty simple and really interesting! Of course you've all heard about the Human Genome Project and how they managed to figure out the sequence of all of those crazy letters that make up who we are, in so few words. I won't tell you everything about how the human genome was put together, but here's the start of it all...
First I should begin with a little review. Think way back into the mists of time... biology classes... ok, enough conjuring. Remember that DNA is a linear molecule made up of nucleotides, that pair one to another to make a double stranded molecule that twists into a double helix. All that stuff is cool for other things but for now, all you need to know is that DNA is like a very very long string of letters, using only the letters A,C,T,G. Well, you can also remember that DNA is copied - happens every time a cell divides, and is a pretty simple process. A DNA polymerase - a little molecular machine that makes DNA - starts at one end of the DNA molecule and works its way to the other, copying as it goes. One important thing: for particular reasons, this copying is always done in the same direction. It's not important what the chemical term is, but for now we'll assume that it always goes left to right (which is the way scientists write it anyways.)
The copying mechanism is simple. In order for anything to happen at all, the polymerase needs to have free nucleotides hanging around, to use as the raw materials to make the new piece of DNA. The process always begins with a primer - basically a little piece of a related molecule called RNA which gives the polymerase somewhere to start. It moves on to the first position that doesn't have a partner, and then sits there and waits for a free nucleotide to come on by. If that one matches, then great -- it sticks it on, and moves on. Otherwise, it doesn't use the mismatch one, but instead waits for the right match. (Usually. When it sticks the wrong one on, that's called a mutation and if it happens in real life, you could get anything from a different hair color to, well, very bad things...) And the thing just keeps going like this until it runs out of DNA to copy, then everything falls apart and you're done.
Scientists knew about this whole copying thing for a while before they even figured out how to get the sequence of what they were copying! But a very bright guy named Sanger figured out how to use this natural process to his advantage. It involves a special molecule called a dideoxy nucleotide. The only difference between a dideoxy nucleotide and a regular nucleotide is that the dideoxy one can be added to a growing DNA chain, but once it's on there, you can't add any more. It physically doesn't have the attachment site where the next one would go. "Well, that's all well and good," you might say, "but what good does it do us to break the thing as it's working?" Just remember, scientists are very good at carefully breaking things to figure out how they work...
It works like this. Let's go back and start copying again. But this time we'll throw in a few of these dideoxy nucleotides. What do you think will happen? Well, if we have a lot more of the regular nucleotides around, it'll be just fine -- until we happen to grab a dideoxy one. That one will go on just fine, but once it's on, the game's up, everything falls apart and you have to start over again. This all happens randomly, though, so you get a whole mess of different molecules. But, since DNA is always copied going the same direction, and starting from the same place (with the same primer) they all begin with the same sequence!
A picture helps:
Template: CTCACCCTGTAGGTGTTCCAGG
----------------------
Copies: GAGTGGGACATCCACAa
GAGTGGGa
GAGTGGGACATc
GAGt
GAGTGg
GAGTGGGACATCCACAAGGTc
That's just a mess. But what if we sort all of these sequences by their length...
Template: CTCACCCTGTAGGTGTTCCAGG
----------------------
Copies: GAGTGGGACATCCACAAGGTc
GAGTGGGACATCCACAa
GAGTGGGACATc
GAGTGGGa
GAGTGg
GAGt
Ahh, now we're getting somewhere. This is just a short list, but since there's so many molecules in solution, there will be a bunch for every possible length. If we could just take this mixed-up soup and sort it by the length of each DNA molecule, we could just read off the last nucleotide in each sequence and that would tell us the entire sequence!
Well, that sorting method exists. It's called gel electrophoresis, and while the nuts and bolts aren't too important, what is important to understand about it is that short, light pieces of DNA move through a gel much quicker than long, heavy pieces of DNA. If you look at the gel after it's finished separating everything, you see bands, and the bands at the far end are made of DNA molecules that are smaller than the bands at the near end. And if you do it just right, you can separate molecules that are only different by one nucleotide.
So then, the whole thing put together: You take the DNA you want to sequence, a bit of primer, a lot of regular nucleotides and a few dideoxy nucleotides, mix them all up for a little bit, then put them through gel electrophoresis and you get these bands where each band is made of a bunch of molecules which all have the same sequence and end in the same dideoxy nucleotide.
Uh oh, we forgot one thing! How do we actually figure out what that nucleotide really is? They used to do a kind of messy thing where they would actually do four of these things together, with only one kind of dideoxy nucleotide at a time, and use radioactivity to sense things... it took a lot of time and resources. Nowadays, it's really neat. What they do is use dideoxy nucleotides with little fluorescent molecules attached to them. Each kind of dideoxy nucleotide (A,C,T,G) has a different color attached to it. Then they take the gel that they got from gel electrophoresis and scan it with a laser and read all four colors at the same time. If you look at the top of this page, you'll see a short piece of one of these scans. Each different color line is a different kind of dideoxy nucleotide, and the peaks of those lines are the actual bands that you can see in the gel! Since each band has only one kind of dideoxy molecule, at the end, you only get one color per band. The letters above the peaks correspond to the sequence that the computer figured out -- simply by taking the color of the highest peak at each position. In case you were wondering, it's not too important why they're all different heights.
So that's how they read DNA sequences. If you bug me, I can tell you more about those RNA primers - they're key to the whole thing. Oh yeah, there's one other thing that you have to keep in mind. This process works great - for sequences up to about 500 nucleotides. Maybe 700 if you're lucky. More than that, the bands get too squished together. So then, the human genome - which has 3 billion nucleotides - had to be broken up into these little pieces. And each piece was sequenced. Several times, to make sure they didn't have any mistakes. And then a computer had to take these tiny little fragments and put them together... but that's a tale for another day.
Posted by kgutwin at 07:40 PM | Comments (1) | TrackBack
May 19, 2005
Star Wars, opening night
You will never find a more wretched hive of nerds and geekery.
10:20 pm - an hour and 40 minutes before showtime. I've been here since about 9:30, sitting in these comfy theater seats and chatting with Matthew. It certainly is an experience. Mostly chatting about Star Wars related stuff although Heather keeps talking about old Brandeis folks.
11:40 pm - just about showtime. I knuckled under and bought soda and popcorn for $2. I hope my bladder doesn't regret it later. Of course, at least this shouldn't be the marathon that is the Lord of the Rings... Matthew and Heather are taking a pit stop, though. The geekiness just doesn't get any bigger than this, folks.
2:21 am - movie over. Never before seen a line at the mens bathroom without a line at the womens ;) pretty cool flick. Very moody. Girls, avoid moody boys - they might just be dark Sith lords...
Sent from: Karl Gutwin
Posted by kgutwin at 02:25 AM | Comments (3) | TrackBack
May 15, 2005
"This is going to be a killer story!"
Now, I'm not suggesting that this phrase was ever uttered in the boardrooms of Newsweek magazine. But I find it interesting, how sometimes our news media wields unexpected power.
Most Westerners have no real conception as to why Muslims venerate their holy book so much. Christianity doesn't explicitly teach respect for the physical copy of the scriptures, and our society is such that if a similar report alleged desecration of the Bible, most people would simply cluck their tongues and move on.
I could rattle on about how our sensationalist media stops at nothing to get a story out there, how there are no longer standards of editorial decency, yadda yadda yadda but I honestly don't think that's the problem in this case. I think simply that here the editors saw it as a standard case of exposing government mishandling, completely appropriate to print in such a rag as Newsweek, and that nobody foresaw the death and destruction that would result.
My heart goes out to the reporter here. Aside from being frustrated, since he is probably taking most of the heat for this, he has to think that had he not published this story, at least twelve people would still be alive today. It's hard to imagine he saw the publication of this story as having the life or death consequences it had.
If you can withstand the irony of the situation, you can read Newsweek's own take on the situation here: http://www.msnbc.msn.com/id/7857407/site/newsweek/
Posted by kgutwin at 03:46 PM | Comments (49) | TrackBack
May 13, 2005
This is why I go to MIT
More information at this web page.
By the way, I want one of these.
p.s. sorry I haven't been posting but work has been weighing me down... I'll get some time in a few days though so check back soon!
Posted by kgutwin at 12:18 PM | Comments (64) | TrackBack