May 24, 2005
Reading The Story of Life
Who wants to learn about DNA sequencing? Come on, come on, it's pretty simple and really interesting! Of course you've all heard about the Human Genome Project and how they managed to figure out the sequence of all of those crazy letters that make up who we are, in so few words. I won't tell you everything about how the human genome was put together, but here's the start of it all...
First I should begin with a little review. Think way back into the mists of time... biology classes... ok, enough conjuring. Remember that DNA is a linear molecule made up of nucleotides, that pair one to another to make a double stranded molecule that twists into a double helix. All that stuff is cool for other things but for now, all you need to know is that DNA is like a very very long string of letters, using only the letters A,C,T,G. Well, you can also remember that DNA is copied - happens every time a cell divides, and is a pretty simple process. A DNA polymerase - a little molecular machine that makes DNA - starts at one end of the DNA molecule and works its way to the other, copying as it goes. One important thing: for particular reasons, this copying is always done in the same direction. It's not important what the chemical term is, but for now we'll assume that it always goes left to right (which is the way scientists write it anyways.)
The copying mechanism is simple. In order for anything to happen at all, the polymerase needs to have free nucleotides hanging around, to use as the raw materials to make the new piece of DNA. The process always begins with a primer - basically a little piece of a related molecule called RNA which gives the polymerase somewhere to start. It moves on to the first position that doesn't have a partner, and then sits there and waits for a free nucleotide to come on by. If that one matches, then great -- it sticks it on, and moves on. Otherwise, it doesn't use the mismatch one, but instead waits for the right match. (Usually. When it sticks the wrong one on, that's called a mutation and if it happens in real life, you could get anything from a different hair color to, well, very bad things...) And the thing just keeps going like this until it runs out of DNA to copy, then everything falls apart and you're done.
Scientists knew about this whole copying thing for a while before they even figured out how to get the sequence of what they were copying! But a very bright guy named Sanger figured out how to use this natural process to his advantage. It involves a special molecule called a dideoxy nucleotide. The only difference between a dideoxy nucleotide and a regular nucleotide is that the dideoxy one can be added to a growing DNA chain, but once it's on there, you can't add any more. It physically doesn't have the attachment site where the next one would go. "Well, that's all well and good," you might say, "but what good does it do us to break the thing as it's working?" Just remember, scientists are very good at carefully breaking things to figure out how they work...
It works like this. Let's go back and start copying again. But this time we'll throw in a few of these dideoxy nucleotides. What do you think will happen? Well, if we have a lot more of the regular nucleotides around, it'll be just fine -- until we happen to grab a dideoxy one. That one will go on just fine, but once it's on, the game's up, everything falls apart and you have to start over again. This all happens randomly, though, so you get a whole mess of different molecules. But, since DNA is always copied going the same direction, and starting from the same place (with the same primer) they all begin with the same sequence!
A picture helps:
Template: CTCACCCTGTAGGTGTTCCAGG
----------------------
Copies: GAGTGGGACATCCACAa
GAGTGGGa
GAGTGGGACATc
GAGt
GAGTGg
GAGTGGGACATCCACAAGGTc
That's just a mess. But what if we sort all of these sequences by their length...
Template: CTCACCCTGTAGGTGTTCCAGG
----------------------
Copies: GAGTGGGACATCCACAAGGTc
GAGTGGGACATCCACAa
GAGTGGGACATc
GAGTGGGa
GAGTGg
GAGt
Ahh, now we're getting somewhere. This is just a short list, but since there's so many molecules in solution, there will be a bunch for every possible length. If we could just take this mixed-up soup and sort it by the length of each DNA molecule, we could just read off the last nucleotide in each sequence and that would tell us the entire sequence!
Well, that sorting method exists. It's called gel electrophoresis, and while the nuts and bolts aren't too important, what is important to understand about it is that short, light pieces of DNA move through a gel much quicker than long, heavy pieces of DNA. If you look at the gel after it's finished separating everything, you see bands, and the bands at the far end are made of DNA molecules that are smaller than the bands at the near end. And if you do it just right, you can separate molecules that are only different by one nucleotide.
So then, the whole thing put together: You take the DNA you want to sequence, a bit of primer, a lot of regular nucleotides and a few dideoxy nucleotides, mix them all up for a little bit, then put them through gel electrophoresis and you get these bands where each band is made of a bunch of molecules which all have the same sequence and end in the same dideoxy nucleotide.
Uh oh, we forgot one thing! How do we actually figure out what that nucleotide really is? They used to do a kind of messy thing where they would actually do four of these things together, with only one kind of dideoxy nucleotide at a time, and use radioactivity to sense things... it took a lot of time and resources. Nowadays, it's really neat. What they do is use dideoxy nucleotides with little fluorescent molecules attached to them. Each kind of dideoxy nucleotide (A,C,T,G) has a different color attached to it. Then they take the gel that they got from gel electrophoresis and scan it with a laser and read all four colors at the same time. If you look at the top of this page, you'll see a short piece of one of these scans. Each different color line is a different kind of dideoxy nucleotide, and the peaks of those lines are the actual bands that you can see in the gel! Since each band has only one kind of dideoxy molecule, at the end, you only get one color per band. The letters above the peaks correspond to the sequence that the computer figured out -- simply by taking the color of the highest peak at each position. In case you were wondering, it's not too important why they're all different heights.
So that's how they read DNA sequences. If you bug me, I can tell you more about those RNA primers - they're key to the whole thing. Oh yeah, there's one other thing that you have to keep in mind. This process works great - for sequences up to about 500 nucleotides. Maybe 700 if you're lucky. More than that, the bands get too squished together. So then, the human genome - which has 3 billion nucleotides - had to be broken up into these little pieces. And each piece was sequenced. Several times, to make sure they didn't have any mistakes. And then a computer had to take these tiny little fragments and put them together... but that's a tale for another day.
Posted by kgutwin at 07:40 PM | Comments (1) | TrackBack
April 24, 2005
Osmo-what?
Osmotic pressure? You want me to talk about osmotic pressure? Well, sure... but why do you ask?
Ha, so ok, it was my idea. But I think it's kind of a neat thing.
Aqueous solutions, like many other chemical systems, tend towards equilibrium. Decoded: if you put a chunk of salt in a pot of water, the salt will slowly dissolve, but will spread the saltiness through the whole pot of water rather than all the saltiness just staying where the chunk of salt was. This process happens by diffusion, which we think we understand intuitively because it happens so often (smells spreading through a room, seasonings spreading in a dish) but really there's a chemical basis to it which can have some pretty nifty effects.
Diffusion really works like the following. Imagine a box. Now put some rubber balls in the box that never stop bouncing - the superest super balls you can find. This box is actually a pretty good approximation of what chemists call an ideal gas. OK, so this box is cool, but it's not useful yet. Let's take all the balls out of the box, and put in a divider so that the box is split in two halves. Let's put holes in this divider that are big enough for the balls to fit through but not so big that the divider isn't there any more :) Now, let's put all the balls back in the box, but we'll put them all on one side of the divider. As the balls bounce around, every once in a while one will approach the divider but will be going at just the right angle so that it goes through the hole and on to the other side. The probability that a ball will make this transition across the divider is a function of a few things: the average ball speed, the size of the hole relative to the size of the ball, and the number of balls on one side.
Now you can imagine what would happen over time. First we start with all the balls on one side. Every once in a while a ball would cross over, but it's far more likely at first that a ball will go from the more-balls side to the less-balls side than the other way around. And eventually there will be the same number of balls on both sides, so the probability of transitioning will be equal and the system is said to be at equilibrium.
Ok, fine, this is all good, but what does it have to do with osmotic pressure? And what is osmotic pressure in the first place? Well, osmosis is the diffusion of water across a semipermeable membrane. It is not, as college students think, that mysterious process where you learn things by sleeping with your textbook under your pillow. In fact, if you put "osmosis is sleeping with your textbook under your pillow" on your chemistry exam then you should have at least been paying enough attention in class to know what osmosis means! Ahem, anyway... osmosis is interesting because there are lots of semipermeable membranes out there. By the way, the definition of a semipermable membrane is a lot like that divider I described above. You could imagine that the divider has holes big enough to fit your superballs through but not baseballs. That's a semipermable membrane, and the most common one that we all deal with on a regular basis is the cell membrane, called the "lipid bilayer" by us biogeeks. All cells have at least one of these membranes, and the cool thing about them is that they let water through, but not big molecules like proteins. This is a very good thing! Otherwise, of course, we would just fall to pieces as all our proteins leaked out.
There is something pretty important, though, about the passage of water across these membranes. See, it's a curious chemical fact that aqueous solutions (stuff dissolved in water) tend towards equilibrium. What that really means is that if you take two different solutions, let's say different amounts of regular table salt dissolved in water, and you put them on either side of a semipermeable membrane which lets water molecules through but not salt ions (this is easy because salt ions are relatively big compared to water molecules) the water will move from the lower salt concentration to the higher salt concentration. It does this because the water wants to be in the same concentration everywhere, and it moves through the membrane in order to bring these concentrations to equilibrium.
But wait, you say, this is silly, if the membrane wasn't there the same thing would happen. Yes, of course, it's the same thing that happens when you put a chunk of salt in a pot of water, the area near the salt gets really salty really quickly, but the water moves in to even things out and slowly the salt diffuses through the whole pot. The point of the membrane is that as the water moves, the salt does not! Which means that you end up having different volumes of solution on either side of the membrane. And any time a volume changes, a pressure is involved... hence osmotic pressure.
Osmotic pressure has several important uses and/or connotations. First, you've all probably heard about reverse osmosis water filters. Well, the osmosis is just what I just described. The reverse part is because the filter works by having a semipermeable membrane where one side has a higher solute concentration (a solute is anything dissolved in a solvent, in this case water) compared to the other; water is added to the the high-solute side and pressurized to overcome the backwards osmotic pressure. This produces clean water on the low-solute side since only water can pass through the membrane.
The other important thing about osmotic pressure is related to biology. As I mentioned above, the most common semipermeable membrane is the cell membrane. It's probably also obvious that cells are chocked full packed of nice solutes like proteins and sugars and salt ions and all sorts of other neat molecules. Well, this is all very useful for the cell but there's one slight problem - if the cell ever interacts with pure water with very little dissolved solute, an osmotic flow happens where the water outside the cell rushes into the cell in order to try to equilibrate the solute concentrations. This creates a pressure inside the cell and the cell literally blows up like a balloon. If the pressure is too great, then the cell bursts! This is why, if you're severely dehydrated, they give you a saline IV which has dissolved salts equal to the dissolved salt in the blood. Otherwise, if you got an IV of pure water, your blood cells would explode and you would get very sick very quickly. This is also why people can die from drinking too much water. We don't drink saline water (for some crazy reason I don't really know why) so if you drink lots and lots and lots of water the salt concentration in the blood drops and you get the same problem of blood cells bursting as well as other cells. This only would happen if you drank like gallons of pure water.
So the moral of this story: When running a marathon, take the Gatorade cups (which have dissolved salts! they like to call them 'electrolytes') rather than the water cups.
P.S. Oh yeah, one more thing. It's way past my bedtime but I think this is the coolest osmosis-related thing. So you know how plants get kinda limp and flabby if you don't water them? Or if they die? Well, here's why - it's osmosis related! Every plant cell has a giant water bubble inside it called a vacuole. This bubble is surrounded by a membrane, yes, a semipermeable membrane like all other biomembranes, which has molecular pumps imbedded in it. So when the cell is alive, those pumps pump salt ions (like potassium and chloride) into the vacuole. As this happens, water molecules follow naturally across the membrane, causing the vacuole to pressurize and expand outwards. This causes the whole cell to pressurize and to stiffen up against the cell walls. Hence, nice firm plants, crisp lettuce, etc.! If you forget to water your plant, though, those pumps stop running, the ions leak out and so does the water - which is a good thing for the plant because it keeps it alive at the cost of a little flabbiness. And if the plant dies, the pumps stop completely and all the ions and water leak out and the plant goes completely limp. So water your plants! They thank you.
Posted by kgutwin at 10:03 PM | Comments (4) | TrackBack
April 18, 2005
From Earth to Earth
Here it is, the inaugural installment of Science Corner!
All right, enough with the fanfare. Let's get down to business. I'll start with the write-ins.
My father asked three questions, perfectly valid and intellectually intriguing I might add, but since it's my blog I'll respond in the order that I choose :) The first question is really quite amusing...
Why do outhouses have a half-moon on their door?
According to The Straight Dope, a very thorough and reliable online source for information about those funny questions we've always had, the moon on an outhouse door actually has nothing really to do with the highschool definition of "mooning". It actually appears as though the concept of moons on outhouse doors is limited to our imagination, as Cecil rightly points out that it is tough to recall ever actually seeing a real outhouse with a moon on its door. Nevertheless, he has traced the origins of this phenomenon through a few ancient and definitive tomes, and his conclusion is that both the moon and the sun were used in illiterate times to delineate between women and men, respectively. It is also likely that not only is it more difficult to carve a sun out of an outhouse door than a moon, but that women's outhouses were generally better maintained than the men's, and so popular conception has passed the moon as the universal sign of relief when Nature calls.
What is the maximum power output of the human body through muscles?
It's an interesting question, and spans a lot of thought space - everywhere from projects in micro power generation in third world countries to The Matrix (yeah, that's right, Coppertop!) Real numbers are hard to come by, though. Part of the problem is in that definition of maximum. I would guess that very few experiments have actually been done to determine the true maximum - because that would likely kill a person, if not destroy their muscles! Another related point is that the power output depends strongly on the load - i.e. the system is nonlinear. Everybody could agree that to walk across a very shallow incline seems to take much less effort than traveling the same height completely vertically, even if ultimately the potential energy gained is equivalent (Science-speak: potential energy is a state function -- translation: it doesn't matter how you get there, the result is still the same.) What this all means is that you might get different numbers for max power output depending on how hard the person is working (or how hard you're making them work!) Oh yeah, one last point too. You asked about the maximum human power output using muscles, but it's a physical impossibility to have every muscle in our body contributing simultaneously to this hypothetical power measurement, since many muscles pull against each other! So most tests of this kind only really measure leg output since that's where the most powerful muscles in the body are.
A really crummy Figure 1 shows several power curves for "healthy men", "first-class athletes" and estimated maximum. Taking one somewhat clear data point from that graph, Eddy Merckx was able to sustain 440W for one hour, or about 0.6 HP. This is a measure of power, power being energy over time. You asked for this in ergs, ergs being a unit of energy, so the energy expended by Mr. Merckx was 440 watts * 60 minutes in ergs which Google Calculator can easily handle. 1.54 x 1013 ergs is the simple, ballpark answer.
This seems like a lot of ergs, but an erg isn't very much energy. An erg per second is about a tenth of a microwatt. Compared to a lawn mower? Which lawn mower? A push lawnmower has about 4 HP. A riding lawnmower can have up to 12 HP. Energy to energy, this amount of energy would run a 4 HP lawnmower for almost 9 minutes or a 12 HP lawnmower for almost 3 minutes. Of course there are reel-type lawn mowers which a normal human can push for more than 9 minutes so clearly 4 HP is pretty inefficient.
What happens to an onion when it is cooked?
What a tasty question! Onions are such a versatile ingredient, and every food changes chemically when it is cooked, so this is a very important thing to understand. I should point out that the definitive reference for these questions is a book titled On Food and Cooking by Harold McGee. Unfortunately I don't have a copy of this book (hint, hint) so I will have to make do with Internet sources and what I can glean by Amazon's "Search inside the book" (what a useful feature!)
Onions are a member of the genus Allium, which also includes such esteemed members as garlic and chives. The most distinctive thing about the alliums is that they contain compounds which are normally sequestered inside vacuoles (cellular compartments). When these plants are cut or crushed, these compounds combine to form the lachrymators, chemicals which make you teary! Different plants have different levels of these lachrymators, but they are the common compound which give onions through leeks their 'bite'. When cooked, these compounds mostly break down and somewhat react with each other in certain ways depending on the heat and what they are cooked in. This breakdown tends to remove a lot of the sharpness of the onion flavor. Hot fats likely have their strongest effect because they even the heat out significantly and can reach temperatures higher than boiling. One thing not to be taken too lightly is the effect of heat on the sugars that onions contain. We don't often think of onions as sweet (except perhaps the sweet onions like Vidalia) but it turns out that most onions have roughly the same sugar content - the sweet ones simply have less of the lachrymatory chemicals! (This means also that soaking yellow onions in several changes of cool water will tend to remove their sharp flavor and make them taste sweeter.) Those sugars can break down and combine with each other during caramelization, producing a mild, sweet flavor.
Next time, if all goes well, I'll make some mention about the current state of the art in smell chemistry and what makes such a lovely smell or a horrid stink! See you soon!
Posted by kgutwin at 04:13 PM | Comments (2) | TrackBack